Total:$39.00
Psilocybe ingeli : MycoTrue(TM) Isolate Vial
$39.00
6 in stock
Bulk discounts available!
Buy 4 or more products and automatically recieve a 15% discount.
Description
MycoTrue(TM) – DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.
Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.
Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below
Psilocybe ingeli
All current samples of Psilocybe ingeli are descendent from a single collection made in 2023 by Talan Moult in the Ingeli mountains of South Africa. Alkaloid testing has found it to be on par with, or exceeding P. zapotecorum and Panaeolus cyanescens. It is very vigorous, fast-growing and produces fruits easily under a variety of conditions.
Description
- Pileus (Cap): Pileus 1–3 cm diam, convex to hemispheric, umbonate, margin straight, occasionally slightly incurved, translucently striate, striations run about half of the way up the pileus, smooth surface, with a separable gelatinous pellicle, caramel brown when moist, fading to light gray when dry, slight bluing around the pileus margin with handling.
- Lamellae (Gills): Lamellae sinuate, light gray when young, maturing to dark brown, margin whitish.
- Stipe (Stem): 3–7 × 0.2–0.6 cm, scaled to pruinose, scales white, caramel brown, base with white mycelium, bluing when damaged, pseudorhiza absent.
- Spore print: Dark purple-brown.
Microscopic Features
- Spores: (7.5–)8–9(–9) × (5–)5–6(–6.5) × 6–7.5 μm (¯???? = 8.5 ± 0.3 × 6 ± 0.3 μm, Q = 1.5– 1.4), ovate to ellipsoid, thick-walled, approximately 1 μm thick.
- Basidia: 15–25 × 6–9 μm, sterigmata mostly 3–5 μm long, hyaline, rarely with granular contents, cylindrical, mostly 2-sterigmate.
- Pleurocystidia: Scattered, 12–25 × 5–9 μm, hyaline, clavate to sublageniform, rostrum common.
- Cheilocystidia: Abundant on lamellae margin, 11–21 × 4–8 μm, hyaline, sublageniform to subclavate, rostrum common.
Ecology & Distribution
- Habitat: On soil in pastures enriched with bovine manure.
- Range: Only known from grasslands near Harding, Kwa-Zulu Natal (South Africa), in the Ingeli mountain range.
- Season: Late summer, after the rainy season.
Phylogeny
- Section: Zapotecorum.
ITS SEQUENCE:
TCGTAGGTGACCTGCGGAGGACATTATTGAATGAACTTGACTCAGTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATCAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT
HOW TO UTILIZE MYCOTRUE VIALS – (SEE LINKED VIDEO)
- Remove syringe and syringe filter from packaging.
- Attach syringe filter to syringe.
- Draw plunger to fill syringe with air.
- Remove syringe filter from syringe.
- Attach needle to syringe.
- Shake vial vigorously.
- Remove cap from vial.
- Insert needle through top of vial, into air space above the solution.
- Inject an amount of air equal to the amount of solution you wish to draw.
- Invert vial and release pressure on plunger to draw out solution
- Turn upright and remove syringe from the vial.
- Cap syringe.
Additional information
| Weight | 0.025 kg |
|---|---|
| Dimensions | 4 × 2 × 2 cm |



Reviews
There are no reviews yet.