Skip to the content
CULTURE CAVE
  • Home
  • Visit Shop
  • Contact Us
  • My account
  • FAQ Page
Login / Register
0
02
  • Koh Samui Cube
    Psilocybe cubensis : Koh Samui Spore Syringe (MS)

    $20.00

    Quantity: 1

  • Psilocybe zapotecorum
    Psilocybe zapotecorum : MycoTrue(TM) Isolate Vial

    $39.00

    Quantity: 1

Total:$59.00

View Cart & Checkout
CULTURE CAVE
  • Home
  • Visit Shop
  • Contact Us
  • My account
  • FAQ Page
Login / Register
0
02
  • Koh Samui Cube
    Psilocybe cubensis : Koh Samui Spore Syringe (MS)

    $20.00

    Quantity: 1

  • Psilocybe zapotecorum
    Psilocybe zapotecorum : MycoTrue(TM) Isolate Vial

    $39.00

    Quantity: 1

Total:$59.00

View Cart & Checkout

What are you looking for?

What are you looking for?

CULTURE CAVE
02
  • Koh Samui Cube
    Psilocybe cubensis : Koh Samui Spore Syringe (MS)

    $20.00

    Quantity: 1

  • Psilocybe zapotecorum
    Psilocybe zapotecorum : MycoTrue(TM) Isolate Vial

    $39.00

    Quantity: 1

Total:$59.00

View Cart & Checkout
  • Home
  • Visit Shop
  • Contact Us
  • My account
  • FAQ Page
HomeShopMycoTrue(TM) VialsPsilocybe ingeli : MycoTrue(TM) Isolate Vial
“Psilocybe zapotecorum : MycoTrue(TM) Isolate Vial” has been added to your cart. View cart
Psilocybe ingeli : MycoTrue(TM) Vial

Psilocybe ingeli : MycoTrue(TM) Isolate Vial

$39.00

6 in stock

Bulk discounts available!

Buy 4 or more products and automatically recieve a 15% discount.

Add to wishlist
SKU: MycTru-385 Category:MycoTrue(TM) Vials
  • Description
  • Additional information
  • Reviews (0)

Description

MycoTrue(TM) – DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

 

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

 

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

 

Psilocybe ingeli

All current samples of Psilocybe ingeli are descendent from a single collection made in 2023 by Talan Moult in the Ingeli mountains of South Africa. Alkaloid testing has found it to be on par with, or exceeding P. zapotecorum and Panaeolus cyanescens. It is very vigorous, fast-growing and produces fruits easily under a variety of conditions.

 

Description

  • Pileus (Cap): Pileus 1–3 cm diam, convex to hemispheric, umbonate, margin straight, occasionally slightly incurved, translucently striate, striations run about half of the way up the pileus, smooth surface, with a separable gelatinous pellicle, caramel brown when moist, fading to light gray when dry, slight bluing around the pileus margin with handling.
  • Lamellae (Gills): Lamellae sinuate, light gray when young, maturing to dark brown, margin whitish.
  • Stipe (Stem): 3–7 × 0.2–0.6 cm, scaled to pruinose, scales white, caramel brown, base with white mycelium, bluing when damaged, pseudorhiza absent.
  • Spore print: Dark purple-brown.

Microscopic Features

  • Spores: (7.5–)8–9(–9) × (5–)5–6(–6.5) × 6–7.5 μm (¯???? = 8.5 ± 0.3 × 6 ± 0.3 μm, Q = 1.5– 1.4), ovate to ellipsoid, thick-walled, approximately 1 μm thick.
  • Basidia: 15–25 × 6–9 μm, sterigmata mostly 3–5 μm long, hyaline, rarely with granular contents, cylindrical, mostly 2-sterigmate.
  • Pleurocystidia: Scattered, 12–25 × 5–9 μm, hyaline, clavate to sublageniform, rostrum common.
  • Cheilocystidia: Abundant on lamellae margin, 11–21 × 4–8 μm, hyaline, sublageniform to subclavate, rostrum common.

Ecology & Distribution

  • Habitat: On soil in pastures enriched with bovine manure.
  • Range: Only known from grasslands near Harding, Kwa-Zulu Natal (South Africa), in the Ingeli mountain range.
  • Season: Late summer, after the rainy season.

Phylogeny

  • Section: Zapotecorum.

ITS SEQUENCE:


TCGTAGGTGACCTGCGGAGGACATTATTGAATGAACTTGACTCAGTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATCAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT

 

HOW TO UTILIZE MYCOTRUE VIALS – (SEE LINKED VIDEO)

 

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

Additional information

Weight 0.025 kg
Dimensions 4 × 2 × 2 cm

Reviews

There are no reviews yet.

Be the first to review “Psilocybe ingeli : MycoTrue(TM) Isolate Vial” Cancel reply

Your email address will not be published. Required fields are marked *

12345

Related products

  • Add to Compare
    Psilocybe zapotecorum
    Psilocybe zapotecorum : MycoTrue(TM) Isolate Vial
    MycoTrue(TM) Vials
    $39.00
    Add to wishlist
    Add to cart
  • Add to Compare
    Psilocybe natalensis : MycoTrue(TM) Isolate Vial
    Psilocybe natalensis : MycoTrue(TM) Isolate Vial
    MycoTrue(TM) Vials
    $39.00
    Add to wishlist
    Add to cart
all card payments accepted
Newsletter

sign up for exclusive discounts.

    contact us
    help@sporeworks.com
    9-5 EST Mon-Sun : 802-444-0111
    contact us now!
    microscopy use only
    all spore Material
    sold for microscopy use only
    amscope b250 is recommended to use for studying
    © 2026 Sporeworks
    Back to top
    CULTURE CAVE
    • Home
    • Visit Shop
    • Contact Us
    • My account
    • FAQ Page
    • Login
    • Register
    • Reset Password
    Lost Your password?